Gene Information: dmsr-6
| Name | dmsr-6 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y54G11B.1 |
| Genetic position | II:23.01 +/- 0.000 cM |
| Genomic position | II: 14455632..14464933 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8823 | dmsr-6(sy1530) II. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaatacttactaatttaaaatttttagCCTATA right flanking sequence: CTCTAACGTTCATCCTTTCTTGTCATTCATCCTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGGATGAACGTTAGAGTAT Method Reference: G3 (Bethesda). |