Gene Information: msp-40

Namemsp-40 View on WormBase
Species C. elegans
SequenceC33F10.9
Genetic positionII:-3.01 +/- 0.004 cM
Genomic positionII: 4825414..4825797

Strains carrying this gene

Strain Genotype Description
PS9048 msp-40(sy1604) II. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACACCCCGGATGGAGCTGCTAAGCAATTCCGCCG Right flanking sequence: TGAGTGGTTCCAAGGAGACGGCATGGTTCGTCGTAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCTTGGAACCACTCACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616