Gene Information: lgc-43
| Name | lgc-43 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C43F9.9 |
| Genetic position | IV:4.64 +/- 0.000 cM |
| Genomic position | IV: 10578667..10581801 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8731 | lgc-43(sy1496) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cttctaattttcagAAGTTTTAACAACCGAAG right flanking sequence: CGTCAACTGATTCTTCTTCTCCAACATCGAGCATATTTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGAAGAATCAGTTGACGCTT Method Reference: G3 (Bethesda). |