Gene Information: dmsr-15

Namedmsr-15 View on WormBase
Species C. elegans
SequenceT15B7.13
Genetic positionV:0.30 +/- 0.000 cM
Genomic positionV: 6827071..6828886

Strains carrying this gene

Strain Genotype Description
PS8894 dmsr-15(sy1563) V. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-15; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: AAAAAACATGTCAGAAAATAAAAATCGCGGAGATA Right flanking sequence: TTTCGGATTGTCAACAAAATTTGCTCGATTCAAATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAAAAATCGCGGAGATATTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616