Gene Information: otpl-1
Name | otpl-1 View on WormBase |
---|---|
Species | C. elegans |
Sequence | B0212.1 |
Genetic position | IV:-3.14 +/- 0.003 cM |
Genomic position | IV: 3568979..3577770 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
PS8751 | otpl-1(sy1510) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCACTGTTCTTAACCATTTTCTCACTGGTACTCG right flanking sequence: AGCTGGCTCACTTGCTCAATGATGAGGAATCCCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTCACTGGTACTCGAGC Method Reference: G3 (Bethesda). |