Gene Information: otpl-1

Nameotpl-1 View on WormBase
Species C. elegans
SequenceB0212.1
Genetic positionIV:-3.14 +/- 0.003 cM
Genomic positionIV: 3568979..3577770

Strains carrying this gene

Strain Genotype Description
PS8751 otpl-1(sy1510) IV. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCACTGTTCTTAACCATTTTCTCACTGGTACTCG right flanking sequence: AGCTGGCTCACTTGCTCAATGATGAGGAATCCCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTCACTGGTACTCGAGC Method Reference: G3 (Bethesda).