Gene Information: lgc-30
| Name | lgc-30 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F58H7.3 |
| Genetic position | IV:-23.02 +/- 0.036 cM |
| Genomic position | IV: 924882..939736 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8721 | lgc-30(sy1486) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-30. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCTTCATCCCGAAAAAACTAATAAAAAAGCCGCCG right flanking sequence: GCTATCGACGACACGGCGTTTCATCGGCGTCGAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCGTGTCGTCGATAGCCGG Method Reference: G3 (Bethesda). |