Gene Information: dmsr-3

Namedmsr-3 View on WormBase
Species C. elegans
SequenceY48C3A.11
Genetic positionII:16.70 +/- 0.000 cM
Genomic positionII: 13340645..13356192

Strains carrying this gene

Strain Genotype Description
PS8858 dmsr-3(sy1543) II. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACGGTATTCGAGACGTTTCTCCTCGAATAT Right flanking sequence: GGGAGGATAATTCACCCGCCGATGGTCCTACTTTTATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGTTTCTCCTCGAATATGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616