Gene Information: clec-88
| Name | clec-88 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | K10B2.3 |
| Genetic position | II:-0.38 +/- 0.001 cM |
| Genomic position | II: 6365722..6367002 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8578 | clec-88(sy1409) II. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: TTGGTATGTGCAGTTACTAACGATATTGAAGACGC right flanking sequence: TAGTGGAGAGACACCTGGAATTGTTTCTCAAATTAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGATATTGAAGACGCTAG Method Reference: G3 (Bethesda). |