Gene Information: C04G6.4

NameC04G6.4 View on WormBase
Species C. elegans
SequenceC04G6.4
Genetic positionII:-2.53 +/- 0.000 cM
Genomic positionII: 5081490..5083441

Strains carrying this gene

Strain Genotype Description
PS7960 C04G6.4(sy1165) II. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C04G6.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGAAGCCACTTTCTTTCGAAATGCCAAAACCGCCA Right flanking sequence: GTTCTCCAGCCAAATATTGCCTCACTTCTACAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATATTTGGCTGGAGAACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616