Gene Information: tbx-43
| Name | tbx-43 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y46E12A.4 |
| Genetic position | III:-17.06 +/- 0.468 cM |
| Genomic position | III: 1765407..1770093 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| MLC1776 | tbx-43(luc131) III. | Wild-type morphology. CRISPR/Cas9 engineered 952 bp deletion of the tbx-43 locus. Flanking sequence: aattagtttttagctccagaagtcggggccgcgccacgttgcatgctcgg / ggcgcttatggaaaaatcattgtggcgggaattcgattcgcagtgtaatg Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421 |