University of Minnesota Driven to Discover logo

Caenorhabditis Genetics Center (CGC)

    • Sign In

    Gene Information: F57G12.1

    NameF57G12.1 View on WormBase
    Species C. elegans
    SequenceF57G12.1
    Genetic positionX:7.01 +/- 0.000 cM
    Genomic positionX: 12169094..12171681

    Strains carrying this gene

    • «
    • 1
    Strain Genotype Description
    VC4117 F57G12.1(gk5196) X. Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is A->T, flanking sequences CTCTTTGCGTGGTCTCTGACGCTCGGTTGG and TAATCGATGATCACCTGGCGTGTGAAAGGC.
    • Job Opportunities within the CGC
    • CGC Home
    • Search Strains
    • Register
      (existing labs)
    • Request a Lab Code
      (new labs)
    • Strain List
      • Recently Added Strains
      • Endogenously-tagged Loci
      • Protein depletion strains NEW!
      • Wild Isolates
        (Caenorhabditis sp.)
      • Wild Isolates
        (non-Caenorhabditis sp.)
      • Strain List (text file)
    • Strain Donation
      (Users must be signed in)
    • Request Knockout
      (of Alzheimer's related genes)
    • Lab List
    • Acknowledging the CGC
    • Contact
    • Frequently Asked Questions (FAQs)
    • Conditions Of Use

    • What Is C. elegans?
    • Nomenclature

    • CaeNDR - the Caenorhabditis Natural Diversity Resource
    • WormAtlas
    • WormBase
    • National Bioresource Project for the Experimental Animal
      C. elegans
    • WormBuilder
    • WormBook
    • WormBook in Genetics