Gene Information: ZK1225.1

NameZK1225.1 View on WormBase
Species C. elegans
SequenceZK1225.1
Genetic positionI:17.26 +/- 0.000 cM
Genomic positionI: 13205612..13207835

Strains carrying this gene

Strain Genotype Description
VC4134 ZK1225.1(gk5216) I. Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5216 mutation is C->T, flanking sequences AAATACACTCTGGAATCATACGCATCAATT and GAAGATATTATCCTACCAACAAGTTTATTA.