Gene Information: col-137
| Name | col-137 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y51H4A.9 |
| Genetic position | IV:15.14 +/- 0.000 cM |
| Genomic position | IV: 16601480..16602776 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8822 | col-137(sy1529) IV. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-137. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATCGCAATTTCCACGATTGCAACTCTGACCGCTA right flanking sequence: TCTTGGCAATTCCAATGTTGTACAATTACATGCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACTCTGACCGCTATCT Method Reference: G3 (Bethesda). |