Gene Information: lgc-37
| Name | lgc-37 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | ZC482.5 |
| Genetic position | III:18.88 +/- 0.047 cM |
| Genomic position | III: 12785154..12793176 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS8727 | lgc-37(sy1492) III. | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-37. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATAATTCCCATCATTGCTCTAATCCATGGACATCATT right flanking sequence: CTCAGGCTGTCATAGACATGAAGAGACAACGgtaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATCCATGGACATCATTCTC Method Reference: G3 (Bethesda). |