Go to the U of M home page

Caenorhabditis Genetics Center (CGC)

    • Sign In

    Gene Information: Y37H9A.1

    NameY37H9A.1 View on WormBase
    Species C. elegans
    SequenceY37H9A.1
    Genetic positionI:21.66 +/- 0.000 cM
    Genomic positionI: 13773067..13778784

    Strains carrying this gene

    • «
    • 1
    Strain Genotype Description
    VC4086 Y37H9A.1(gk5174) .I Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5174 mutation is G->A, flanking sequences AAATCCCTAGAAAAAAATCGATTTTTTTCA and CTTCCACCGAAAATTCAACGTGTAGAATCC.
    • Job Opportunities within the CGC
    • CGC Home
    • Search Strains
    • Register
      (existing labs)
    • Request a Lab Code
      (new labs)
    • Strain List
      • Recently Added Strains
      • Endogenously-tagged Loci
      • Wild Isolates
        (Caenorhabditis sp.)
      • Wild Isolates
        (non-Caenorhabditis sp.)
      • Strain List (text file)
    • Strain Donation
      (Users must be signed in)
    • Request Knockout
      (of Alzheimer's related genes)
    • Lab List
    • Acknowledging the CGC
    • Contact
    • Frequently Asked Questions (FAQs)
    • Conditions Of Use

    • What Is C. elegans?
    • Nomenclature

    • CaeNDR - the Caenorhabditis Natural Diversity Resource
    • WormAtlas
    • WormBase
    • National Bioresource Project for the Experimental Animal
      C. elegans
    • WormBuilder
    • WormBook
    • WormBook in Genetics