Gene Information: pals-16

Namepals-16 View on WormBase
Species C. elegans
SequenceY82E9BR.4
Genetic positionIII:-21.88 +/- 0.000 cM
Genomic positionIII: 1399970..1401401

Strains carrying this gene

Strain Genotype Description
PS8181 pals-16(sy1207) III. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAATCATTGACAAATTGCAGAACATCAACACCTT Right flanking sequence: Ggtaggttgaagaagttattattggaatttgaaat inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGAACATCAACACCTTGGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616