Gene Information: Y106G6H.8
| Name | Y106G6H.8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y106G6H.8 |
| Genetic position | I:5.04 +/- 0.000 cM |
| Genomic position | I: 10452178..10452895 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| PS7833 | Y106G6H.8(sy1076) I. | Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of Y106G6H.8 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTAATCTCCCCACCAAGTGTCGATATGTCTCCAATT; right flanking sequence: ATTCGTCTGGCTGGCCTCTCGGGAGCTGTTGCCATTTC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda). |