Gene Information: ZK637.2

NameZK637.2 View on WormBase
Species C. elegans
SequenceZK637.2
Genetic positionIII:-0.01 +/- 0.000 cM
Genomic positionIII: 8887751..8890143

Strains carrying this gene

Strain Genotype Description
PS8785 ZK637.2(sy1518) III. Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZK637.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATGAGATGATTGACGATTTGGATAAGACCTATT right flanking sequence: TGAGGGATATGCAGAAGAGCATGTTTCAGTGCTCAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTCTGCATATCCCTCAAAT Method Reference: G3 (Bethesda).