Gene Information: T03F6.10

NameT03F6.10 View on WormBase
Species C. elegans
SequenceT03F6.10
Genetic positionIII:21.21 +/- 0.000 cM
Genomic positionIII: 13377842..13378342

Strains carrying this gene

Strain Genotype Description
VC4112 T03F6.10(gk5189) III. Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5189 mutation is C->T, flanking sequences AATGAGAGCAATGAGAAGAAGCATAAAAAT and TGGAAATATAGAAATATACTTACTTTTAAG.