Gene Information: K09C4.10
| Name | K09C4.10 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | K09C4.10 |
| Genetic position | X:-10.59 +/- 0.000 cM |
| Genomic position | X: 3276007..3280230 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4158 | AH9.1(gk5243) K09C4.10(gk5244) X. | Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5243 mutation is C->T, flanking sequences TTCAGTCCGACTGTTTTGTGATGGCTGTCT and CAGAACCAATTACGTTTGTCAATTTTCCGC. The gk5244 mutation is C->A, flanking sequences TGTCTGATCCTTTCTCAATAGTTCCATCCT and GCGCTTTTCAGCAATATGATTTTCAGATCC. |