Gene Information: T27E7.4
Name | T27E7.4 View on WormBase |
---|---|
Species | C. elegans |
Sequence | T27E7.4 |
Genetic position | IV:12.19 +/- 0.000 cM |
Genomic position | IV: 14533518..14535067 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4084 | T27E7.4(gk5171) IV; irk-2(gk5172) X. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT. |