Gene Information: glct-4
| Name | glct-4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C47F8.4 |
| Genetic position | I:13.12 +/- 0.001 cM |
| Genomic position | I: 12317321..12318735 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4157 | glct-4(gk5241) I; C05D2.8(gk5242) III. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5241 mutation is C->T, flanking sequences GAGCTTCCACAACGACTCCTCCGACTAGGC and TGAAATTTTAGGGGGTTCTGGGATTGAGGT. The gk5242 mutation is C->T, flanking sequences ACAATATCCCTCTCTCCTCCATCACCACCC and ACTGAGAATTCATCAAATTTTCTTTATTGT. |