Gene Information: glct-4

Nameglct-4 View on WormBase
Species C. elegans
SequenceC47F8.4
Genetic positionI:13.12 +/- 0.001 cM
Genomic positionI: 12317321..12318735

Strains carrying this gene

Strain Genotype Description
VC4157 glct-4(gk5241) I; C05D2.8(gk5242) III. Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5241 mutation is C->T, flanking sequences GAGCTTCCACAACGACTCCTCCGACTAGGC and TGAAATTTTAGGGGGTTCTGGGATTGAGGT. The gk5242 mutation is C->T, flanking sequences ACAATATCCCTCTCTCCTCCATCACCACCC and ACTGAGAATTCATCAAATTTTCTTTATTGT.