Gene Information: C05D2.8

NameC05D2.8 View on WormBase
Species C. elegans
SequenceC05D2.8
Genetic positionIII:-1.48 +/- 0.000 cM
Genomic positionIII: 5607509..5610346

Strains carrying this gene

Strain Genotype Description
VC4157 glct-4(gk5241) I; C05D2.8(gk5242) III. Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5241 mutation is C->T, flanking sequences GAGCTTCCACAACGACTCCTCCGACTAGGC and TGAAATTTTAGGGGGTTCTGGGATTGAGGT. The gk5242 mutation is C->T, flanking sequences ACAATATCCCTCTCTCCTCCATCACCACCC and ACTGAGAATTCATCAAATTTTCTTTATTGT.