Gene Information: C05D2.8
| Name | C05D2.8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C05D2.8 |
| Genetic position | III:-1.48 +/- 0.000 cM |
| Genomic position | III: 5607509..5610346 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4157 | glct-4(gk5241) I; C05D2.8(gk5242) III. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5241 mutation is C->T, flanking sequences GAGCTTCCACAACGACTCCTCCGACTAGGC and TGAAATTTTAGGGGGTTCTGGGATTGAGGT. The gk5242 mutation is C->T, flanking sequences ACAATATCCCTCTCTCCTCCATCACCACCC and ACTGAGAATTCATCAAATTTTCTTTATTGT. |