Gene Information: sre-40
| Name | sre-40 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T05A7.8 |
| Genetic position | II:-3.65 +/- 0.007 cM |
| Genomic position | II: 4681715..4683793 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4113 | K12C11.6(gk5190) I; sre-40(gk5191) II. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA. |