Gene Information: C34F11.1
| Name | C34F11.1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C34F11.1 |
| Genetic position | II:-1.93 +/- 0.000 cM |
| Genomic position | II: 5212975..5213932 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4178 | W03G9.2(gk5265) I; C34F11.1(gk5266) II. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5265 mutation is G->A, flanking sequences GAAATGACCGCCGAACTGAAGAAGTTAAAG and TGATATATACAACAATGAACAATCACTAAT. The gk5266 mutation is C->T, flanking sequences TCAGGCTCATGGCGAGCTCTTCCAGTGGCA and AAGGCGGTTCCTCACATATTCGTATCTGGC. |