Gene Information: fbxa-139

Namefbxa-139 View on WormBase
Species C. elegans
SequenceB0391.9
Genetic positionV:8.41 +/- 0.005 cM
Genomic positionV: 15593384..15594673

Strains carrying this gene

Strain Genotype Description
VC4209 C29F9.8(gk5294) III; fbxa-139(gk5295) V. Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5294 mutation is C->T, flanking sequences CAGAAAAGTACAAATTTGCCTGGATTTTGC and TGAAAATTTTTATCAAAAAACCGGCAAATT. The gk5295 mutation is G->A, flanking sequences GATTAAATCTGATTAGATGAAGCTCAAATC and ATCGAAGTTGTAGAGATACTCCATTGGCAT.