Gene Information: srbc-70

Namesrbc-70 View on WormBase
Species C. elegans
SequenceF30B5.6
Genetic positionIV:-0.07 +/- 0.008 cM
Genomic positionIV: 4226858..4228017

Strains carrying this gene

Strain Genotype Description
VC4135 fbxa-182(gk5217) II; srbc-70(gk5218) IV. Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5217 mutation is C->T, flanking sequences GCTGATGCGGACATCCAACTTAGTTAAAAT and CATTCATTTGTGGCTTGACATAAATTATAT. The gk5218 mutation is C->T, flanking sequences GTGATCAGTTCTATTTTTGGTGCAGAACTT and CAGACGAAAAGTCGAATGGCAAGAACTGCT.