Gene Information: C29F9.8

NameC29F9.8 View on WormBase
Species C. elegans
SequenceC29F9.8
Genetic positionIII:-26.99 +/- 0.000 cM
Genomic positionIII: 96783..97118

Strains carrying this gene

Strain Genotype Description
VC4209 C29F9.8(gk5294) III; fbxa-139(gk5295) V. Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5294 mutation is C->T, flanking sequences CAGAAAAGTACAAATTTGCCTGGATTTTGC and TGAAAATTTTTATCAAAAAACCGGCAAATT. The gk5295 mutation is G->A, flanking sequences GATTAAATCTGATTAGATGAAGCTCAAATC and ATCGAAGTTGTAGAGATACTCCATTGGCAT.