Gene Information: klp-3

Nameklp-3 View on WormBase
Species C. elegans
SequenceT09A5.2
Genetic positionII:0.58 +/- 0.001 cM
Genomic positionII: 7842353..7845653

Strains carrying this gene

Strain Genotype Description
RG3138 klp-3(ve638[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 3142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttttgtctccgttttttgcgttgttttcct ; Right flanking sequence: tccattctagtccatgaaaaatttcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.