Gene Information: clx-1
| Name | clx-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C50F7.2 |
| Genetic position | IV:3.46 +/- 0.005 cM |
| Genomic position | IV: 7734648..7736324 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3081 | clx-1(ve581[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 2495 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgggaatgttgtggaactttgaatctatg ; Right flanking sequence: gtttttcgccattttgattcgggttcgact. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |