Gene Information: F20A1.1

NameF20A1.1 View on WormBase
Species C. elegans
SequenceF20A1.1
Genetic positionV:0.50 +/- 0.000 cM
Genomic positionV: 7051715..7052179

Strains carrying this gene

Strain Genotype Description
RG3097 F20A1.1(ve597[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 544 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: actaatcaccactacgtgtcgtcacaattc ; Right flanking sequence: aagactacagtaacgggtgaaatatcgaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.