Gene Information: fndc-1

Namefndc-1 View on WormBase
Species C. elegans
SequenceT06D8.7
Genetic positionII:3.37 +/- 0.000 cM
Genomic positionII: 11236624..11237325

Strains carrying this gene

Strain Genotype Description
RG3133 fndc-1(ve633[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. homozygous viable. Deletion of 641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgaagaaaaaaatagacagcatgactagac ; Right flanking sequence: gctggaacaatcacagtactacattactcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.