Gene Information: C25H3.3

NameC25H3.3 View on WormBase
Species C. elegans
SequenceC25H3.3
Genetic positionII:-0.97 +/- 0.000 cM
Genomic positionII: 5694193..5695237

Strains carrying this gene

Strain Genotype Description
RG3070 C25H3.3(ve570[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Homozygous viable. Deletion of 1006 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gccgcattttggacccaagatttcgcgtct ; Right flanking sequence: acaatttctaatttgatcgttttgaaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.