Gene Information: sss-1

Namesss-1 View on WormBase
Species C. elegans
SequenceF32B6.5
Genetic positionIV:4.44 +/- 0.000 cM
Genomic positionIV: 9892739..9893749

Strains carrying this gene

Strain Genotype Description
VC4538 sss-1(gk5609[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTTATAGAGAGAGGTTTAGAGAGAGAGCA. Right flanking sequence: AGGTTTAAGGTTTAAAAAATGCGACAAAGACATTTTTTGGACAATATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.