Gene Information: sss-1
| Name | sss-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F32B6.5 |
| Genetic position | IV:4.44 +/- 0.000 cM |
| Genomic position | IV: 9892739..9893749 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4538 | sss-1(gk5609[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTTATAGAGAGAGGTTTAGAGAGAGAGCA. Right flanking sequence: AGGTTTAAGGTTTAAAAAATGCGACAAAGACATTTTTTGGACAATATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |