Gene Information: F53B7.7

NameF53B7.7 View on WormBase
Species C. elegans
SequenceF53B7.7
Genetic positionV:2.88 +/- 0.000 cM
Genomic positionV: 10999097..10999671

Strains carrying this gene

Strain Genotype Description
RG3122 F53B7.7(ve622[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaaaaagtgcaacgtgcggaattccctaa ; Right flanking sequence: GATACACTTATTCACACATACTATCCAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.