Gene Information: F18A1.7
| Name | F18A1.7 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F18A1.7 |
| Genetic position | II:0.51 +/- 0.000 cM |
| Genomic position | II: 7662706..7663754 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3096 | F18A1.7(ve596[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1089 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acatatttgtgtcgggtgattatttacaat ; Right flanking sequence: aggtcatataaggaaaagaacagctaggta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |