Gene Information: F17H10.1
| Name | F17H10.1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F17H10.1 |
| Genetic position | X:10.21 +/- 0.000 cM |
| Genomic position | X: 13105241..13108543 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3095 | F17H10.1(ve595[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 4865 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcactctgtccgcgtttctttgaccgcat ; Right flanking sequence: tagcctcgtaatgtagcagatacccaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |