Gene Information: lips-15

Namelips-15 View on WormBase
Species C. elegans
SequenceY38E10A.7
Genetic positionII:10.46 +/- 0.000 cM
Genomic positionII: 12604386..12607027

Strains carrying this gene

Strain Genotype Description
RG3189 lips-15(ve689[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1143 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: taggtacttccccgtataaaagagaacccc ; Right flanking sequence: ttcctttttttattatcagaaatccgtatt. sgRNA #1: gagtgaagattgtggagtta; sgRNA #2: aatatgcggatggatttatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.