Gene Information: lips-11

Namelips-11 View on WormBase
Species C. elegans
SequenceT13B5.5
Genetic positionII:-15.57 +/- 0.000 cM
Genomic positionII: 1108841..1111001

Strains carrying this gene

Strain Genotype Description
RG3185 lips-11(ve685[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 2595 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cgtgggtcgaacctccgacctatttctcca ; Right flanking sequence: ggtgcctcatcttatcagttgtgcttttca. sgRNA #1: actggtaacacggacgacta; sgRNA #2: tgagtgtctagacatggcaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.