Gene Information: clec-178
| Name | clec-178 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T19E7.1 |
| Genetic position | IV:2.03 +/- 0.005 cM |
| Genomic position | IV: 5653949..5655003 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3129 | clec-178(ve629[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | homozygous viable. Deletion of 954 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacttacgcaataggtatattccctaaa ; Right flanking sequence: gtaggataggttttactgtcagaagcttcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |