Gene Information: C25E10.16

NameC25E10.16 View on WormBase
Species C. elegans
SequenceC25E10.16
Genetic positionV:1.92 +/- 0.000 cM
Genomic positionV: 9058401..9059568

Strains carrying this gene

Strain Genotype Description
RG3075 C25E10.16(ve575[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Homozygous viable. Deletion of 1085 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: taaggtagcaccatcgaaaaaaaacctcat ; Right flanking sequence: tgtgggttggtatggagaattggagacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.