Gene Information: nlp-42

Namenlp-42 View on WormBase
Species C. elegans
SequenceY80D3A.10
Genetic positionV:18.46 +/- 0.002 cM
Genomic positionV: 18903772..18906252

Strains carrying this gene

Strain Genotype Description
HBR1971 nlp-42(syb235) V. Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.