Gene Information: R07E3.7

NameR07E3.7 View on WormBase
Species C. elegans
SequenceR07E3.7
Genetic positionX:1.97 +/- 0.000 cM
Genomic positionX: 10341732..10355750

Strains carrying this gene

Strain Genotype Description
VC4124 R07E3.7(gk5204) X. Homozygous viable. Nonsense allele identified by amplicon sequencing.The gk5204 mutation is A->T, flanking sequences TGGAGGTTGCTTTTTGTCTTTTGATCGTAT and CAGAAAAATAGGATGAGAATCAACAGAACG.