Caenorhabditis Genetics Center (CGC)

Gene Information: clec-199

Nameclec-199 View on WormBase
Species C. elegans
SequenceC30H6.1
Genetic positionIV:16.52 +/- 0.000 cM
Genomic positionIV: 17351886..17358097

Strains carrying this gene

Strain Genotype Description
VC4119 clec-199(gk5198) IV. Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC.
VC4809 clec-199(gk5877[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 5972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GTAGTTCCGTTCTGACAGTTCTTTGTTAAG. Right flanking sequence: TGGCGCAACGAGGAACTTGGAGACCTTATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.