Gene Information: mir-793
Name | mir-793 View on WormBase |
---|---|
Species | C. elegans |
Sequence | M03B6.6 |
Genetic position | X:15.05 +/- 0.000 cM |
Genomic position | X: 13857962..13858053 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VT3297 | maIs105 V; mir-793(ma292) X. | maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11]. |