Gene Information: mir-793

Namemir-793 View on WormBase
Species C. elegans
SequenceM03B6.6
Genetic positionX:15.05 +/- 0.000 cM
Genomic positionX: 13857962..13858053

Strains carrying this gene

Strain Genotype Description
VT3297 maIs105 V; mir-793(ma292) X. maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11].