Gene Information: C36B7.3

NameC36B7.3 View on WormBase
Species C. elegans
SequenceC36B7.3
Genetic positionX:-1.86 +/- 0.000 cM
Genomic positionX: 7101777..7102231

Strains carrying this gene

Strain Genotype Description
VC4121 C36B7.3(gk5200) ent-2(gk5201) X. Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA.