Gene Information: F54B11.7
| Name | F54B11.7 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F54B11.7 |
| Genetic position | X:13.88 +/- 0.000 cM |
| Genomic position | X: 13600436..13601534 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4095 | srz-5(gk5186) II; R09H10.7(gk5187) IV; F54B11.7(gk5188) X. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG. |