Gene Information: srz-5
| Name | srz-5 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y49F6B.11 |
| Genetic position | II:-6.25 +/- 0.001 cM |
| Genomic position | II: 3512690..3514731 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4095 | srz-5(gk5186) II; R09H10.7(gk5187) IV; F54B11.7(gk5188) X. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG. |