Gene Information: C04F5.8
| Name | C04F5.8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C04F5.8 |
| Genetic position | V:-2.50 +/- 0.000 cM |
| Genomic position | V: 5111518..5113754 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3059 | C04F5.8(ve559[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 2256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: CCGAGTCCCCGTGAGCTCTCGAATCCCGTA ; Right flanking sequence: atgggttactgtagcgcttgtatcgattta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |