Gene Information: C04F5.8

NameC04F5.8 View on WormBase
Species C. elegans
SequenceC04F5.8
Genetic positionV:-2.50 +/- 0.000 cM
Genomic positionV: 5111518..5113754

Strains carrying this gene

Strain Genotype Description
RG3059 C04F5.8(ve559[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Homozygous viable. Deletion of 2256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: CCGAGTCCCCGTGAGCTCTCGAATCCCGTA ; Right flanking sequence: atgggttactgtagcgcttgtatcgattta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.