Gene Information: sue-1

Namesue-1 View on WormBase
Species C. elegans
SequenceF07A5.5
Genetic positionI:1.98 +/- 0.019 cM
Genomic positionI: 7360226..7371534

Strains carrying this gene

Strain Genotype Description
RG3054 sue-1(ve554[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Homozygous viable. Deletion of 10676 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaattttgtgggaataaacgcacaccgcga ; Right flanking sequence: caaggtgaaaaagaaaacaaatagttactg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.