Gene Information: sue-1
Name | sue-1 View on WormBase |
---|---|
Species | C. elegans |
Sequence | F07A5.5 |
Genetic position | I:1.98 +/- 0.019 cM |
Genomic position | I: 7360226..7371534 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
RG3054 | sue-1(ve554[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 10676 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaattttgtgggaataaacgcacaccgcga ; Right flanking sequence: caaggtgaaaaagaaaacaaatagttactg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |